rabbit anti mouse polyclonal zo 1 antibody  (Proteintech)

Journal: Pharmaceutics

Article Title: Efficacy and Safety of a Brain-Penetrant Biologic TNF-α Inhibitor in Aged APP/PS1 Mice

doi: 10.3390/pharmaceutics14102200

Figure Lengend Snippet: Effect of TfRMAb-TNFR on BBB tight-junction proteins and brain inflammation. Chronic TfRMAb-TNFR dosing in aged APP/PS1 mice significantly increased ZO-1 ( a ) and claudin-5 ( b ) compared to the saline-treated mice measured using Western blotting of the cerebrum homogenates. Both TfRMAb-TNFR and etanercept increased I ĸ Bα in the cerebrum homogenates compared to the saline-treated mice ( c ). Data are presented as mean ± SD of n = 4–9 per treatment group, and data were analyzed using the one-way ANOVA with the Holm Sidak’s post hoc test. * p < 0.05 and ** p < 0.01 for the indicated comparisons.

Article Snippet: Membranes were probed at 4 °C overnight with anti-mouse zonula occludens-1 (ZO-1) rabbit polyclonal antibody (1:1000 in 3% milk, Thermo Fisher Scientific, Waltham, MA, USA), anti-human amyloid precursor protein (APP) mouse monoclonal antibody (1:1000 in 3% milk, BioLegend, San Diego, CA, USA), anti-claudin-5 mouse monoclonal antibody (1:1000 in 3% milk, Santa Cruz Biotechnology, Dallas, TX, USA), anti-β-site APP cleaving enzyme 1 (BACE1) rabbit polyclonal antibody (1:1000 in 3% milk, Thermo Fisher Scientific, Waltham, MA, USA), anti-IκBα mouse monoclonal antibody (1:1000 in 3% milk, Cell Signaling Technology, Danvers, MA, USA), anti-TfR-1 mouse monoclonal antibody (1:1000 in 3% milk, Thermo Fisher Scientific, Waltham, MA, USA), anti-TfR-2 mouse monoclonal antibody (1:1000 in 3% milk, Thermo Fisher Scientific, Waltham, MA, USA) and anti-ferroportin rabbit polyclonal antibody (1:1000 in 3% milk, Novus Biologicals, Centennial, CO, USA).

Techniques: Saline, Western Blot

Journal: Developmental biology

Article Title: Developmental SMAD6 Loss Leads to Blood Vessel Hemorrhage and Disrupted Endothelial Cell Junctions

doi: 10.1016/j.ydbio.2018.07.027

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: All key resources used in experiments are listed in the . table ft1 table-wrap mode="anchored" t5 caption a7 Reagent or resource Source Identifier Antibodies Rat monoclonal anti-CD31 BD Pharmingen Cat# 553370; RRID:AB_394816 Rat monoclonal anti-CD31 BD Pharmingen Cat#550274; RRID:AB_393571 Rabbit monoclonal anti-VE-cadherin Cell Signaling Cat# D87F2; RRID:AB_ 2077969 Mouse monoclonal anti-VE-cadherin BV6 Enzo Cat# ALX-803-305-C100; RRID: AB Rabbit polyclonal anti-VE-cadherin Santa Cruz Cat# 28644; RRID:AB_ 2052810 Rabbit polyclonal anti-NG2 Millipore Cat# AB5320; RRID:AB_11213678 Monoclonal anti-actin, alpha-smooth-muscle-Cy3 Sigma-Aldrich Cat# C6198; RRID:AB_476856 Rabbit polyclonal anti-SMAD6 Abcam Cat# ab13727;RRID: AB_300605 Mouse monoclonal anti-GAPDH Cell Signaling Cat# 97166S Rabbit polyclonal anti-ZO-1 ThermoFisher Cat# 61-7300; RRID:AB_138452 Chemicals, Peptides, and Recombinant Proteins Recombinant human BMP6 R&D Systems Cat# 507-BP-020 X-gal Promega Cat# V394A Critical Commercial Assays Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat# L3000008 Experimental Models: Cell Lines Human Umbilical Vein Endothelial Cells Lonza Cat# C2519A Experimental Models: Organisms/Strains Mouse: Smad6 +/− Dr. Karen Lyons ( Estrada et al., 2011 )( Galvin et al., 2000 ) Mouse: Flt1 +/ LacZ Dr. Guo Hua Fong Oligonucleotides F primer for Smad6 +/+ mice: 5’- CCTTGCCATATCCTATGCTTGCG-3’ Eurofins N/A F primer for Smad6 −/− mice: 5’- GCTTCCTCGTGCTTTACGGTATC-3’ Eurofins N/A R primer for Smad6 mice: 5’- GCGCCGCACCGACTCACTGC -3’ Eurofins N/A F primer for m Smad6 retina RNA: 5’-AGCATTTTCTACGACCTACCTCA-3’ Eurofins N/A R primer for m Smad6 retina RNA: 5’-CCTTGATGGAGTAACCCGGTG-3’ Eurofins N/A F primer for m Pecam1 retina RNA: 5’-ATGACCCAGCAACATTCACA-3’ Eurofins N/A R primer for m Pecam1 retina RNA: 5’-CACAGAGCACCGAAGTACCA-3’ Eurofins N/A F primer for mGAPDH retina RNA: 5’-ACCACAGTCCATGCCATCAC-3’ Eurofins N/A R primer for mGAPDH retina RNA: 5’-CACCACCCTGTTGCTGTAGCC-3’ Eurofins N/A Non-targeting siRNA Life Technologies Cat# 4390847 SMAD6 siRNA s8410 Life Technologies Cat# 4392420 SMAD6siRNA s8411 Life Technologies Cat# 4392420 Other DRAQ7 Abcam Cat# ab109202 Isolectin-IB4 Alexa-Fluor 594 conjugate Thermo Fisher Cat# {"type":"entrez-nucleotide","attrs":{"text":"I21413","term_id":"1601767","term_text":"I21413"}} I21413 Alexa-Fluor 594 Phalloidin Invitrogen Cat# A12381 Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Transfection